Facebook non elimina le fake news: le nasconde

In un confronto con giornalisti Facebook ha esplicitato la propria politica sulle fake news: non eliminare, ma nascondere, per rallentarne la viralità.

Facebook non elimina le fake news: le nasconde

Facebook non intende farsi giudice in terra del bene e del male. E per evitare quest’infausto incarico, ammette un passo indietro per non essere giocoforza ultimo interprete del vero e del falso, poiché un singolo errore in questo discrimine rischierebbe di mettere a berlina l’intero gruppo. Una responsabilità troppo grande, che il gruppo non vuole; una potenza di fuoco troppo grande, che nessuno dovrebbe mettere nelle mani di una azienda privata; un compito troppo delicato, che eppure da più parti si vorrebbe abbracciato proprio da Mark Zuckerberg. Insomma, occorre capirsi.

Nel contesto di un meeting con una serie di giornalisti USA, Facebook ha esplicitato quella che è la propria scelta in termini di fake news : non eliminarle dal social network, ma limitarne la divulgazione. E di fronte alle contestazioni su una scelta di questo tipo, Facebook spiega di aver scelto semplicemente la via che ritiene più opportuna.

I toni si accendono sul caso InfoWars , pagina Facebook da quasi 1 milione di follower, che rovista nel complottismo e nella politica per raccogliere consensi. La domanda a cui Facebook non vuole risponde è: perché una pagina simile è ancora online senza che nessuno intervenga? La domanda è a maggior ragione opportuna nei giorni in cui Apple rimuove QDrops dall’App Store per fermare l’incedere del complottismo firmato QAnon, in uno scontro di principio che vede Apple e Facebook assumere due posizioni non certo simili.

Il social network non vuole farsi censore, poiché in tal caso avrebbe due possibilità: agire in proprio nella rimozione delle falsità, oppure affidarsi a debunker terzi esternalizzando oneri e responsabilità. Ciò significherebbe però in ogni caso andare ad agire in quell’immensa terra di mezzo tra il vero e il falso dove ci sarà sempre e comunque un dibattito possibili su quali parti di una affermazione sia vera e quale sia falsa, sempre che la verità possa essere definita o meno e con quali tempi. In questa dinamica manca infatti il terzo potere, quello che dovrebbe stabilire in modo inoppugnabile e senza prova contraria ove stia la ragione e dove stia il torto. Facebook ritiene semplicemente impossibile tutto ciò e, a scanso di apparire come un gruppo che abdica alle proprie responsabilità, preferisce scegliere una via più pragmatica.

La scelta del team Zuckerberg è quindi quella di non eliminare post ipoteticamente etichettabili come “fake news”, ma evitare che possano divulgarsi. Ciò comporta due conseguenze allo stesso tempo, che vanno in direzione opposta e che, in caso di errore, potrebbero consentire comunque alla verità di emergere:

  • se Facebook abbassa il tasso di viralità di una news o di una pagina, tali contenuti più difficilmente incontreranno altri utenti e per semplice questione statistica con minor possibilità diventeranno virali;
  • se Facebook non rimuove i post, limitandosi a frenarne la viralità, consente comunque alle condivisioni di avanzare, così che sia responsabilità dei singoli giudicare il vero e il falso, dando fiato o meno alla voce delle pagine incriminate.

Spesso le persone non sono in grado di distinguere il vero dal falso , spesso la viralità è più conseguenza di distorsioni che non di solide affermazioni, ma Facebook ha buon gioco a smarcarsi da questa impasse: il social network fa la propria parte, gli utenti facciano la propria e il tasso culturale generale (contemplante adeguata consapevolezza e adeguata capacità di discernimento) sia il vero attrito ad opporsi alla capacità delle fake news di prendere il volo. Questo non significa che i social network in generale non debbano essere richiamati alle proprie responsabilità (troppo spesso hanno fatto spallucce di fronte a segnalazioni sufficientemente semplici di violazione), ma ben altra cosa è scaricare sui social network l’intero peso del discernimento tra bianco e nero, vero e falso, tollerabile e intollerabile.

In ballo, è noto, c’è quell’alto concetto di libertà che sempre più spesso viene messo alla prova quando si tratta di Web. Come se una dinamica più generale e più profonda fosse messa in discussione, è sul Web che il Vero e il Falso si trovano sempre più di frequente faccia a faccia a contendersi gli utenti e le ragioni. Occorre però uscire dall’idea di un mondo binario, ove tutto quel che non è vero sia falso e viceversa: è nei meandri del grigio, e nella melma del confronto, che si possono trovare la forza e la ragione per fare un passo avanti verso un mondo migliore.

Facebook non vuole caricarsi sulle spalle tutta questa responsabilità e, altri che non sanno farsene carico, vorrebbero invece attribuirla completamente al social network. Se ogni singolo utente, ognuno per sé, pensasse pochi secondi prima di condividere qualcosa sui social network, forse nessun Atlante dovrebbe farsi carico di sollevare il mondo. E il mondo girerebbe comunque, ogni giorno meglio del precedente.

La tua email sarà utilizzata per comunicarti se qualcuno risponde al tuo commento e non sarà pubblicato. Dichiari di avere preso visione e di accettare quanto previsto dalla informativa privacy

  • Marco Zubbeccher go scrive:
    Facebook
    [img]http://i.imgflip.com/2e8ovr.jpg[/img]
  • ... scrive:
    Re: Ma de-iscrivetevi!
    - Scritto da: bubba
    un trepalline che scrive cose sensate, e' una
    notizia. Sicuro di non essere un fake"..."?
    :DP35S-(ATG)GATGAAATGGAAAACACCGAA
  • bubba scrive:
    Re: Ma de-iscrivetevi!
    - Scritto da: ...
    La decisione di non eliminare può essere di per
    sé giusta e rimanderei a Scorza:

    http://scorza.blogautore.espresso.repubblica.it/20
    Detto questo:
    - Facebook al massimo è solo preoccupato di non
    perdere
    utenti;
    - agire sulla viralità sta a significare che
    Facebook in ogni caso si preserva un discreto
    potere potenziale di agire sulla diffusione di
    notizie, vere o false che
    siano;
    - gli utenti non sanno distinguere vero dal
    falso? Uno è competente per studio o per lavoro
    su uno o pochi argomenti, quindi tutti hanno
    difficoltà se non è il loro campo. Poi c'è da
    distinguere tra chi cerca di informarsi e risale
    alle fonti o si affida a dati non campati per
    aria e chi ha il gene del complotto overespresso.
    Ed è già stato dimostrato che le chambers di
    dementi non le debunki neppure con
    l'atomica.

    L'ultimo video di Cassandra era profetico con
    buona pace di tutti
    noi.un trepalline che scrive cose sensate, e' una notizia. Sicuro di non essere un fake"..."? :D
  • ... scrive:
    Ma de-iscrivetevi!
    La decisione di non eliminare può essere di per sé giusta e rimanderei a Scorza: http://scorza.blogautore.espresso.repubblica.it/2018/01/21/fake-news-la-verita-non-puo-essere-giudicata-a-colpi-di-like-da-una-giuria-popolare/Detto questo:- Facebook al massimo è solo preoccupato di non perdere utenti;- agire sulla viralità sta a significare che Facebook in ogni caso si preserva un discreto potere potenziale di agire sulla diffusione di notizie, vere o false che siano;- gli utenti non sanno distinguere vero dal falso? Uno è competente per studio o per lavoro su uno o pochi argomenti, quindi tutti hanno difficoltà se non è il loro campo. Poi c'è da distinguere tra chi cerca di informarsi e risale alle fonti o si affida a dati non campati per aria e chi ha il gene del complotto overespresso. Ed è già stato dimostrato che le chambers di dementi non le debunki neppure con l'atomica.L'ultimo video di Cassandra era profetico con buona pace di tutti noi.
Chiudi i commenti