UK, la pattuglia dei cybercafé

Iniziativa promossa da Scotland Yard: i vari gestori di Internet café potranno controllare gli hard disk dopo la navigazione dei loro clienti. E, nel caso, informare la polizia. Ma non si parli di spionaggio

Roma – Un particolare poster ha fatto la sua comparsa all’interno di alcuni Internet café della città di Londra. “Il proprietario di questo locale collabora con il servizio di polizia metropolitana, per prevenire l’accesso in Rete a materiale offensivo o illecito”. È stata avviata una robusta campagna da parte di Scotland Yard, benedetta dagli stessi auspici del governo britannico all’interno di una strategia mirata a combattere il terrorismo .

Un poster , ma anche un avviso sul desktop: “Tutti i clienti accettino di non accedere o scaricare alcun contenuto inappropriato durante la navigazione. Né trasmettere o archiviare documenti come email e allegati di natura pornografica, violenta o estremista”. Una sorta di campagna di sensibilizzazione secondo Scotland Yard, mirata a far capire ai vari gestori di Internet café che la polizia di Londra è disposta ad ascoltare eventuali timori e sospetti .

Ma non si parli di incoraggiamento allo spionaggio. “Non si tratta di chiedere ai gestori di spiare i loro clienti – ha spiegato un portavoce della polizia metropolitana rimasto anonimo – ma di spingere alla consapevolezza . Non stiamo chiedendo loro di passarci i dati raccolti”. Un’adesione volontaria dunque, una collaborazione non obbligatoria nella lotta a certi contenuti circolanti in Rete.

Ma, stando a quanto riportato dallo stesso portavoce anonimo, la richiesta del corpo di polizia londinese è stata precisa: i gestori che aderiranno dovranno controllare gli hard drive dei propri computer dopo la navigazione degli utenti. Sempre in modo assolutamente volontario. Anche se l’avviso di Scotland Yard ha poi continuato: “La violazione delle precedenti disposizioni comporterà il blocco immediato dell’accesso alla navigazione e, in alcuni casi, la polizia verrà informata”.

Particolarmente critico, Simon Davies, direttore del gruppo britannico Privacy International . La paura di Davies consiste nella possibilità che ad esempio i musulmani vengano denunciati più frequentemente, dati gli stessi timori del governo in materia di terrorismo via posta elettronica. “Non ci aspetteremmo che le nostre telefonate dalle cabine pubbliche vengano controllate – ha continuato Davies – e questo vale anche per le nostre email”.

Mauro Vecchio

La tua email sarà utilizzata per comunicarti se qualcuno risponde al tuo commento e non sarà pubblicato. Dichiari di avere preso visione e di accettare quanto previsto dalla informativa privacy

  • Controcorre nte scrive:
    Non sono d'accordo
    Non sono del tutto d'accordo e vi spiego il perche'.La ricerca scentifica, lo sappiamo benissimo, costa fior di quattrini perche' serve gente capace, strutture adeguate e soprattutto un sacco di tempo.Queste cose costano, e tanto, per cui l'unico modo di far proseguire le ricerche e' di fornire alle aziende la possibilita' di avere un ritorno economico degli investimenti fatti.Togliendo i brevetti tout court manca questa possibilita', per cui la ricerca verra' drasticamente ridotta.Una cosa intelligente sarebbe stata di ridurre l'impatto dei brevetti, o limitandoli all'applicazione pratica oppure riducendo il periodo di validita' di brevetto a poco tempo, tipo 5 anni.Naturalmente tutto questo imho.
    • James Kirk scrive:
      Re: Non sono d'accordo
      Hai un po' di ragione ... in effetti per studiare, individuare, classificare e poi utilizzare i geni occorre usare il cervello (oltre che i quattrini).E' chiaro che, come in tutto l'ambito della Proprietà Intellettuale, è una questione di stabilire dei compromessi.Tuttavia oggi il sistema è troppo sbilanciato verso i più forti, mentre esso è nato proprio per difendere i deboli dai forti.
      • biotecnolog o scrive:
        Re: Non sono d'accordo
        Come al solito a parlare di questi argomenti sono persone del tutto ignoranti in materia, e si vede a 1 km ("pezzetti di amminoacidi"???, codice genetico usato erroneamente come sinonimo di genoma, ecc...). E infatti non avete idea della regolamentazione che sta sotto la brevettabilità di sequenze nucleotidiche. La ricerca costa decine di milioni di , il brevetto garantisce il ritorno di investimento, essenziale per incentivare l'investimento privato (già, la ricerca pubblica non esiste più) e per avere quel surplus di capitale da investire per nuove scoperte e medicine. Dagli studi su BRCA1 e 2 (che sono 2 delle decine, forse centinaia di geni coinvolti nel cancro) sono derivati test di screening che salvano delle vite. Senza il brevetto quei test non sarebbero stati sviluppati. E questo si applica a quasi tutte le medicine che prendete. Non nego che alcuni ci guadagnino profumatamente, ma per ora non c'è altra strada. La brevettabilità di sequenze si basa sul fatto che non basta "scoprire" una sequenza, ma devi dimostrare che ne hai compresa la funzione. E questo non blocca la ricerca, la incentiva, perché le sequenze sono liberamente disponibili a tutti, il brevetto copre solo l'applicazione. Questo è un pezzo di BRCA1, e potete farci quello che volete: ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA. Quanto agli OGM sorvolo. Quello è un altro settore, la loro brevettabilità è fuori discussione, così come vengono brevettate le nuove varietà vegetali ottenute da incroci. (La loro presunta pericolosità è da anni fuori discussione, smettiamola di fare i bigotti creduloni). Metà dei vegetali che mangiano in usa sono OGM, e probabilmente tutto il cibo importato dall'america ne contiene (dai fast-food ai cereali Kelloggs). Detto questo, meglio se vi attenete all'informatica.
        • Roberto scrive:
          Re: Non sono d'accordo
          Grazie, finalmente un commento appropriato e con del senso.
        • Marsh scrive:
          Re: Non sono d'accordo
          - Scritto da: biotecnolog o(La loro presunta pericolosità è da anni fuori discussione, smettiamola di fare i bigotti creduloni).Ma pericolosità per chi? Parliamo di persone? O parliamo di ecosistemi e di biodiversità (che è già in pericolo di per sé)?
          • biotecnolog o scrive:
            Re: Non sono d'accordo
            L'uomo fa parte dell'ecosistema, e quindi con non pericoloso intendo per entrambi. L'ecosistema non è in pericolo e nemmeno la biodiversità. Stiamo devastando il pianeta con l'inquinamento, il pianeta reagisce evolvendosi, le specie adatte sopravvivono, quelle inadatte si estinguono, chi riesce evolve. Chi crede che gli OGM siano pericolosi è solo perché non sa cosa sono e non sa nulla di evoluzione e selezione naturale.
  • picard12 scrive:
    meravigliosa
    ora estendiamola alle ogm così evitiamo di comprare la patata artificiale per ingrassare le multinazionali ed affamare il III mondo..
    • Calma Interiore scrive:
      Re: meravigliosa
      I pregiudizi e gli slogan non servono a capire le problematiche relative agli OGM.Meglio informarsi seriamente magari iniziando da qui:http://bressanini-lescienze.blogautore.espresso.repubblica.it/2009/03/25/ogm-le-ragioni-di-chi-dice-no/http://bressanini-lescienze.blogautore.espresso.repubblica.it/2008/12/12/gli-ogm-non-sono-sterili-passando-da-vandana-shiva-e-veltroni-a-nanni-moretti/http://bressanini-lescienze.blogautore.espresso.repubblica.it/category/ogm/http://bressanini-lescienze.blogautore.espresso.repubblica.it/2007/11/07/la-papaya-ogm/Buona Pasqua (qualunque cosa significhi) a tutti
      • ullala scrive:
        Re: meravigliosa
        - Scritto da: Calma Interiore
        I pregiudizi e gli slogan non servono a capire le
        problematiche relative agli
        OGM.
        Meglio informarsi seriamente magari iniziando da
        qui:
        http://bressanini-lescienze.blogautore.espresso.re

        http://bressanini-lescienze.blogautore.espresso.re

        http://bressanini-lescienze.blogautore.espresso.re

        http://bressanini-lescienze.blogautore.espresso.re

        Buona Pasqua (qualunque cosa significhi) a tuttiAh bello calmo! Ma fare in modo che le sementi non si riproducano e brevettare il DNA è una feature che è stata introdotta al fine di ridurre la fame, i pregiudizi o cosa di altro? No giusto per sapere! Senza pregiudizio ovviamente eh! :D
        • Calma Interiore scrive:
          Re: meravigliosa
          - Scritto da: ullala
          - Scritto da: Calma Interiore

          I pregiudizi e gli slogan non servono a capire
          le

          problematiche relative agli

          OGM.

          Meglio informarsi seriamente magari iniziando da

          qui:


          http://bressanini-lescienze.blogautore.espresso.re




          http://bressanini-lescienze.blogautore.espresso.re




          http://bressanini-lescienze.blogautore.espresso.re




          http://bressanini-lescienze.blogautore.espresso.re



          Buona Pasqua (qualunque cosa significhi) a tutti
          Ah bello calmo!
          Ma fare in modo che le sementi non si riproducano
          e brevettare il DNA è una feature che è stata
          introdotta al fine di ridurre la fame, i
          pregiudizi o cosa di altro?

          No giusto per sapere!
          Senza pregiudizio ovviamente eh!
          :DSono decenni che vengono prodotte anche sementi sterili, ancor prima che vi fossero gli attuali OGM, OGM che non sono necessariamente sterili per definizione. Vedi: http://biotecnologiebastabugie.blogspot.com/2009/02/volte-ritornano-percy-schmeiser.htmlPer quel che so non è possibile, negli USA ma non solo, brevettare cose gia esistenti in natura come il DNA o parti di DNA. Infatti chi truffaldinamente ci prova viene prima o poi beccato, come dimostra la sentenza dell'articolo. Non è vietato, invece, brevettare tecnologie che permettono di manipolare parti di DNA. Non posso brevettare gli occhi, ma posso brevettare una tecnologia che ridia la vista a chi ne è privo.Senza pretese di aver ragione, ma per riflettere
          • amedeo scrive:
            Re: meravigliosa

            Per quel che so non è possibile, negli USA ma non solo, brevettare cose gia esistenti in natura come il DNA o parti di DNA. Infatti chi truffaldinamente ci prova viene prima o poi beccato, come dimostra la sentenza dell'articolo. Non è vietato, invece, brevettare tecnologie che permettono di manipolare parti di DNA. Non posso brevettare gli occhi, ma posso brevettare una tecnologia che ridia la vista a chi ne è privo.Ma allora cosa autorizza le multinazionali a fare causa al vicino dopo avergli inquinato le coltivazioni con le proprie OGM ? Hanno per caso brevettato l'impollinazione ?
      • picard12 scrive:
        Re: meravigliosa
        ho già studiato parecchio in materia e la mia personale convinzione che gli ogm non servono per salvare il mondo dalla fame, ma solo per ingrassare chi ha saputo, con la compiacenza di governi ignoranti, creare un business molto redditizio a scapito dei paesi poveri che si diceva volere aiutare..Gli articoletti stile grazia moderna non mi interessano..c'è molto altro in bibiliografia, in rete e nella vita reale di chi ha visto come vengono trattate le popolazioni suddette, soprattutto se consideriamo quanto cibo viene prodotto per essere poi distrutto...-----------------------------------------------------------Modificato dall' autore il 02 aprile 2010 17.01-----------------------------------------------------------
  • Giggetto scrive:
    ora che si fa con gli OGM?
    si butta tutto a mare perché modificano pezzi di DNA già esistente?io ne sarei molto contento, tra l'altro..
    • skywalker scrive:
      Re: ora che si fa con gli OGM?
      Chissà. magari si torna al buon senso: si torna a brevettare la tecnologia con cui si ottiene qualcosa, non il prodotto che si ottiene o l'idea.Se sei pigro mi paghi e usi la mia tecnologia, se non vuoi pagare me investi in ricerca e ti trovi un altro modo di ottenere lo stesso risultato. Se è meno efficiente, io continuerò a vendere la mia tecnologia, anche se avrò un prezzo oltre il quale la tua diventa più conveniente. Se è la tua ad essere più efficiente: shame on me, che pur essendo partito prima mi sono seduto sugli allori della prima tecnologia che funzionava, invece di continuare a cercare quella più efficiente.Come si usava dire anni fa: si brevetta la fotocopiatrice, non la fotocopia od il fotocopiare.
      • mah bi scrive:
        Re: ora che si fa con gli OGM?
        che è esattamente quello che prevede la legge italiana :Dma gli usa sono tutt'altro mondo XD
  • Roberto scrive:
    pezzetti di aminoacidi ?
    Oh my...onore alle tue capacita' di giornalista. ma in biologia .... hmmm...
  • ubik scrive:
    peccato
    peccato, mi sarebbe tanto piaciuto brevettare le ghiande e poi chiedere le royalties agli scoiattoli (americani)
    • Valeren scrive:
      Re: peccato
      Da quanto ricordo di Central Park, bisognava evitare gli scoiattoli perché avevano la rabbia.Io manderei quelli della SIAE ad esigere il tributo :D
      • Enjoy with Us scrive:
        Re: peccato
        - Scritto da: Valeren
        Da quanto ricordo di Central Park, bisognava
        evitare gli scoiattoli perché avevano la
        rabbia.
        Io manderei quelli della SIAE ad esigere il
        tributo
        :DSono peggio degli scoiattoli del'idroscalo di Milano?
  • Enjoy with Us scrive:
    Finalmente!
    Basta con questi brevetti sull'aria fritta!Non se ne può più di patent trolling, almeno in campo genetico la pianteranno con certe schifezze!Ma vi rendete conto? Questi cercavano di brevettare singoli geni presenti da vari milioni di anni in qualsiasi ominide, prima ancora che evolvesse in Sapiens!Perchè non brevettare il fuoco o ancora l'alfabeto...
    • Mr. Olotom scrive:
      Re: Finalmente!
      sei un geniocorro subito =D
    • La redazione si riserva di cancellare scrive:
      Re: Finalmente!
      - Scritto da: Enjoy with Us
      Perchè non brevettare il fuoco o ancora
      l'alfabeto...Non fare il simpatico... guarda che il brevetto sulle provocazioni è in mano mia. :D
    • Nedanfor non loggato scrive:
      Re: Finalmente!
      'Sistema di caratteri o segni finalizzati al comunicare'. Dici che me lo accettano XD?
  • panda rossa scrive:
    Comportamenti gia' esistenti in natura.
    Siccome il primate, specie di mammifero a cui appartiene anche l'uomo, ha da sempre imitato i propri simili, questo puo' essere considerato un comportamento innato, esistente da sempre in natura.L'uomo per natura imita e copia.Questa sentenza fa legislatura.Basta copyright!
    • Valeren scrive:
      Re: Comportamenti gia' esistenti in natura.
      Questa sentenza è semplicemente giusta e dovuta, punto.
      • ullala scrive:
        Re: Comportamenti gia' esistenti in natura.
        - Scritto da: Valeren
        Questa sentenza è semplicemente giusta e dovuta,
        punto.Bhe giusta di sicuro... Sul dovuta ... sono certo che Monsanto (e le altre multinazionali deli OGM) non è d'accordo con te... ;)Naturalmente il valore della sentenza è secondo me storico se calcoli che è una sentenza USA (il posto dove la quasi totalità di questo tipo di brevetti sono stati registrati).
        • Enjoy with Us scrive:
          Re: Comportamenti gia' esistenti in natura.
          - Scritto da: ullala
          - Scritto da: Valeren

          Questa sentenza è semplicemente giusta e dovuta,

          punto.

          Bhe giusta di sicuro...
          Sul dovuta ... sono certo che Monsanto (e le
          altre multinazionali deli OGM) non è d'accordo
          con
          te...
          ;)

          Naturalmente il valore della sentenza è secondo
          me storico se calcoli che è una sentenza
          USA (il posto dove la quasi totalità di questo
          tipo di brevetti sono stati
          registrati).Che fallisca pure la Monsanto allora!Questo è un'importante punto di partenza per eliminare certi brevetti odiosi, vedrete che in futuro a questo punto anche gli OGM saranno i benvenuti!
          • Undertaker scrive:
            Re: Comportamenti gia' esistenti in natura.
            - Scritto da: Enjoy with Us
            Che fallisca pure la Monsanto allora!
            Questo è un'importante punto di partenza per
            eliminare certi brevetti odiosi, vedrete che in
            futuro a questo punto anche gli OGM saranno i
            benvenuti!E allora che fallisca la Monsanto e tutte le multinazionali, che le industrie, le banche, le compagnie aeree faliscano tutte !... e ci ritroveremmo come l'Albania alla fine degli anni 80.Sei un demente hippy
        • panda rossa scrive:
          Re: Comportamenti gia' esistenti in natura.
          - Scritto da: ullala
          - Scritto da: Valeren

          Questa sentenza è semplicemente giusta e dovuta,

          punto.

          Bhe giusta di sicuro...
          Sul dovuta ... sono certo che Monsanto (e le
          altre multinazionali deli OGM) non è d'accordo
          con
          te...
          ;)Io non conto una beata fava, quindi fino a ieri Monsanto & C erano semplicemente in disaccordo con me.Oggi invece sono in disaccordo con la corte suprema degli stati uniti e quindi si adeguano.
          • ullala scrive:
            Re: Comportamenti gia' esistenti in natura.
            - Scritto da: panda rossa
            - Scritto da: ullala

            - Scritto da: Valeren


            Questa sentenza è semplicemente giusta e
            dovuta,


            punto.



            Bhe giusta di sicuro...

            Sul dovuta ... sono certo che Monsanto (e le

            altre multinazionali deli OGM) non è d'accordo

            con

            te...

            ;)

            Io non conto una beata fava, Errore madornale!Conti conti eccome!è l'opinione pubblica che ha tenuto fino a ora gli OGM lontani dall'europa.E credimi oppure no... ma secondo me la corte suprema non avrebbe deciso a quel modo se non dopo che gran parte "del mondo" ha reagito in un certo modo.P.S.Più dici di non contare e meno conti!Datti da fare per contare di più (è un ottimo sistema, anzi l'unico, per tentare di avere ragione almeno ogni tanto).
          • panda rossa scrive:
            Re: Comportamenti gia' esistenti in natura.
            - Scritto da: ullala
            P.S.
            Più dici di non contare e meno conti!
            Datti da fare per contare di più (è un ottimo
            sistema, anzi l'unico, per tentare di avere
            ragione almeno ogni
            tanto).uno, due, tre, quattro, cinque, sei, sette, otto, nove, dieci, undici, dodici, tredici, quattordici, quindici, sedici, diciassette, diciotto, diciannove, venti, ventuno, ventidue, ventitre, ventiquattro, venticinque, ventisei...
          • Beeg Gik scrive:
            Re: Comportamenti gia' esistenti in natura.
            Meglio che ti documenti meglio visto che gli OGM sono stati approvati in Europa (Germania, Francia e... nooooooooo... in Italia pureeee...).http://www.molecularlab.it/news/view.asp?n=5712Poi che esistano ricerche che ne denunciano la "potenziale" pericolosità e quindi cerchino di osteggiarne l'uso... ben vengano, purtroppo la carta moneta copre gli occhi e riempie le tasche (spero solo non risponda nessuno che altrimenti non potremmo sostenere l'attuale regime di consumi! una XXXXXXX abnorme!)
          • mah bi scrive:
            Re: Comportamenti gia' esistenti in natura.
            considerando anche che NON ci stanno più : i pomodori di un tempo, i cocomeri sferici e tantissime verdure/frutti/etc di 50 anni fa...è risaputo...persino l'allevamento e la produzione del latte ne è soggetto...etc etc
          • Undertaker scrive:
            Re: Comportamenti gia' esistenti in natura.
            - Scritto da: mah bi
            considerando anche che NON ci stanno più : i
            pomodori di un tempo, i cocomeri sferici e
            tantissime verdure/frutti/etc di 50 anninessuno ti vieta di coltivarli se ne senti la mancanzaIl motivo che queste varietá obsolete di vegetali non vengano piú coltivate é che NON CONVIENE farlo.
        • James Kirk scrive:
          Re: Comportamenti gia' esistenti in natura.
          - Scritto da: ullala

          Naturalmente il valore della sentenza è secondo
          me storico se calcoli che è una sentenza
          USA (il posto dove la quasi totalità di questo
          tipo di brevetti sono stati
          registrati).Per me è un po' presto per rallegrarsi; penso che le Multinazionali la tireranno fino alla Corte Suprema (questa è 'solo' una corte federale) per tentare di avere ragione.
Chiudi i commenti